Effects of magnesium with or without boron on headshaking behavior in horses with trigeminal-mediated headshaking.

BackgroundOral administration of magnesium and boron might have a beneficial effect on headshaking behavior in horses.ObjectiveEvaluate the effects of oral magnesium alone or in combination with boron on headshaking behavior in affected horses.AnimalsTwelve geldings (6 healthy controls and 6 affected).MethodsProspective randomized controlled dietary trial over 42 days in 12 horses (6 horses diagnosed with trigeminal-mediated headshaking and 6 unaffected healthy controls). All horses received a hay diet and were randomized into 3 treatment groups: pelleted feed combination (PF), pelleted feed combination with magnesium (M), and pelleted feed combination with magnesium-boron (MB) with a week washout of hay only between treatments. Headshaking behavior and biochemical blood variables were assessed at baseline (hay only) and then after each week of supplementation.ResultsAll 3 diet interventions increased blood ionized and total magnesium. Groups M and MB further increased Mg2+ when compared to PF. Horses receiving treatments had a significant reduction in headshaking behavior, as measured by incidence rate ratio (IRR), when compared to unsupplemented hay diet (44% for PF, IRR, 0.558; CI, 0.44, 0.72; P < .001; 52% for M, IRR, 0.476; CI, 0.37, 0.62; P < .001; and 64% for MB, IRR, 0.358; CI, 0.27, 0.48; P < .001).Conclusions and clinical importanceMagnesium in combination with boron had the greatest decrease in headshaking. Oral supplementation with magnesium or magnesium in combination with boron should be considered in horses affected with headshaking

Intravenous infusion of magnesium sulfate and its effect on horses with trigeminal-mediated headshaking.

BackgroundTrigeminal-mediated headshaking results from low-threshold firing of the trigeminal nerve resulting in apparent facial pain. Magnesium may have neuroprotective effects on nerve firing that potentially dampen signs of neuropathic pain. This hypothesis has not been investigated in horses with trigeminal-mediated headshaking.ObjectiveTo investigate head-shaking behavior in affected horses after IV magnesium sulfate infusion.AnimalsSix geldings with trigeminal-mediated headshaking.MethodsProspective randomized crossover study. Horses were controlled for diet and infused IV with 5% dextrose solution (DS; control solution at 2 mL/kg body weight [BW]) and MgSO4 50% solution (MSS at 40 mg/kg BW). Head-shaking behavior was recorded at times T0 (baseline, before infusion) and T15, T30, T60, and T120 minutes post-infusion. Venous blood variables such as pH, HCO3 - , standard base excess (SBE), Na+ , Cl- , K+ , Ca2+ , Mg2+ , total magnesium (tMg), glucose, and lactate were measured; strong ion difference (SID) and anion gap (AG) were calculated for each time point.ResultsBlood variables including pH, Na+ , Cl- , K+ , SID, AG, lactate, Ca2+ , tMg, and Mg2+ had significant changes with MSS as compared to DS treatment. Glucose, SBE, and HCO3 - did not have significant changes. A 29% reduction in head-shaking rate occurred after MSS treatment but no change occurred after DS treatment.Conclusions and clinical importanceAdministration of MSS IV increased plasma total and ionized magnesium concentrations and significantly decreased head-shaking behavior in horses with trigeminal-mediated headshaking

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Luteinizing hormone concentrations in healthy horses and horses with trigeminal-mediated headshaking over an 8-hour period.

BackgroundTrigeminal-mediated headshaking results from a low threshold for firing of the trigeminal nerve. A seasonal component has been implicated in onset of clinical signs, which occur during the spring and summer months. Geldings are overrepresented in the affected population and hormonal differences as compared to a healthy control population of geldings might contribute to headshaking.Objective/hypothesisTo assess concentrations of luteinizing hormone (LH) over an 8-hour period in gelded healthy controls and horses affected with headshaking. Our hypothesis was that geldings with seasonal headshaking would have higher concentrations of LH over an 8-hour period compared to control horses during the summer when affected horses manifested headshaking.AnimalsTwelve geldings (6 controls and 6 affected).MethodsProspective controlled trial. Blood samples were drawn every 15 minutes over an 8-hour time period during summer from all horses to measure circulating LH concentrations by using a radioimmunoassay for equine LH. All affected horses were actively affected by headshaking at the time of sample collection.ResultsNo statistically significant differences in LH concentrations were found throughout the study period in headshakers as compared to control horses. Time had no significant effect, but a slight decrease in LH concentrations was observed for all horses. The main limitation of the study was the low number of horses.Conclusions and clinical importanceHorses affected with headshaking did not have significant differences in circulating LH during the late summer as compared to control horses

Pneumonia Caused by Klebsiella spp. in 46 Horses.

BackgroundKlebsiella spp. are implicated as a common cause of bacterial pneumonia in horses, but few reports describe clinical presentation and disease progression.Hypothesis/objectivesTo describe the signalment, clinicopathologic data, radiographic and ultrasonographic findings, antimicrobial susceptibility, outcome, and pathologic lesions associated with Klebsiella spp. pneumonia in horses.AnimalsForty-six horses from which Klebsiella spp. was isolated from the lower respiratory tract.MethodsRetrospective study. Medical records from 1993 to 2013 at the William R. Pritchard Veterinary Medical Teaching Hospital, University of California, Davis were reviewed. Exact logistic regression was performed to determine if any variables were associated with survival to hospital discharge.ResultsSurvival in horses <1 year old was 73%. Overall survival in adults was 63%. For adults in which Klebsiella pneumoniae was the primary isolate, survival was 52%. Mechanical ventilation preceded development of pneumonia in 11 horses. Complications occurred in 25/46 horses, with thrombophlebitis and laminitis occurring most frequently. Multi-drug resistance was found in 47% of bacterial isolates. Variables that significantly impacted survival included hemorrhagic nasal discharge, laminitis, and thoracic radiographs with a sharp demarcation between marked caudal pulmonary alveolar infiltration and more normal-appearing caudodorsal lung.Conclusions and clinical importanceKlebsiella spp. should be considered as a differential diagnosis for horses presenting with hemorrhagic pneumonia and for horses developing pneumonia after mechanical ventilation. Multi-drug resistance is common. Prognosis for survival generally is fair, but is guarded for adult horses in which K. pneumoniae is isolated as the primary organism

Effect of heuristics on serendipity in path-based storytelling with linked data

Path-based storytelling with Linked Data on the Web provides users the ability to discover concepts in an entertaining and educational way. Given a query context, many state-of-the-art pathfinding approaches aim at telling a story that coincides with the user's expectations by investigating paths over Linked Data on the Web. By taking into account serendipity in storytelling, we aim at improving and tailoring existing approaches towards better fitting user expectations so that users are able to discover interesting knowledge without feeling unsure or even lost in the story facts. To this end, we propose to optimize the link estimation between - and the selection of facts in a story by increasing the consistency and relevancy of links between facts through additional domain delineation and refinement steps. In order to address multiple aspects of serendipity, we propose and investigate combinations of weights and heuristics in paths forming the essential building blocks for each story. Our experimental findings with stories based on DBpedia indicate the improvements when applying the optimized algorithm

Accurate time-domain gravitational waveforms for extreme-mass-ratio binaries

The accuracy of time-domain solutions of the inhomogeneous Teukolsky equation is improved significantly. Comparing energy fluxes in gravitational waves with highly accurate frequency-domain results for circular equatorial orbits in Schwarzschild and Kerr, we find agreement to within 1% or better, which we believe can be even further improved. We apply our method to orbits for which frequency-domain calculations have a relative disadvantage, specifically high-eccentricity (elliptical and parabolic) "zoom-whirl" orbits, and find the energy fluxes, waveforms, and characteristic strain in gravitational waves.Comment: 6 pages, 9 figures, 2 tables; Changes: some errors corrected. Comparison with Frequency-domain now done in stronger fiel