Amiloride reduces portal hypertension in rat liver cirrhosis

Objective This study aimed to investigate the effect of amiloride on portal hypertension. Amiloride is known to inhibit Na(+)/H(+) exchangers on activated hepatic stellate cells. Methods Liver cirrhosis in rats was induced by bile duct ligation (BDL) or thioacetamide (TAA) administration. The effects of zymosan for Kupffer cell (KC) activation or a thromboxane (TX) analogue (U46619) were tested in isolated perfused livers of cirrhotic rats and in vivo. Downstream mechanisms were investigated using Rho kinase inhibitor (Y-27632) or amiloride. Acute and chronic effects of amiloride and canrenoate on portal pressure were compared in perfused livers and in vivo. TXB(2) efflux was measured by ELISA. The phosphorylation state of moesin (p-moesin) as an indicator of Rho kinase activity and expression of the thromboxane synthase were assessed by western blot analyses. The activity of hepatic stellate cells was analysed by western blot and staining for alpha-smooth muscle actin (alpha-SMA). Results In BDL rats, KC activation via zymosan increased portal pressure. This was attenuated by the Rho kinase inhibitor Y-27632. Increased thromboxane efflux following zymosan infusion remained unaltered by Y-27632. The infusion of amiloride attenuated zymosan- and U46619-induced increases in portal perfusion pressure. In vivo, direct administration of amiloride, but not of canrenoate, lowered portal pressure. In TAA and BDL rats, treatment with amiloride for 3 days reduced basal portal pressure and KC-induced increases in portal pressure whereas canrenoate had no effect. In livers of amiloride-treated animals, the phosphorylation state of moesin and the number of alpha-SMA positive cells were reduced. Conclusions Amiloride lowers portal pressure in rat liver cirrhosis by inhibition of intrahepatic vasocontraction. Therefore, patients with cirrhosis and portal hypertension may benefit from amiloride therapy

Silodosin inhibits noradrenaline-activated transcription factors Elk1 and SRF in human prostate smooth muscle.

The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation

Contribution of a time-dependent metric on the dynamics of an interface between two immiscible electro-magnetically controllable Fluids

We consider the case of a deformable material interface between two immiscible moving media, both of them being magnetiable. The time dependence of the metric at the interface introduces a non linear term, proportional to the mean curvature, in the surface dynamical equations of mass momentum and angular momentum. We take into account the effects of that term also in the singular magnetic and electric fields inside the interface which lead to the existence of currents and charges densities through the interface, from the derivation of the Maxwell equations inside both bulks and the interface. Also, we give the expression for the entropy production and of the different thermo-dynamical fluxes. Our results enlarge previous results from other theories where the specific role of the time dependent surface metric was insufficiently stressed.Comment: 25 page

How Can Heterogeneity Be Countered with the Help of Digital Media

https://remix.berklee.edu/able-assembly-conference/1074/thumbnail.jp

Who Follows Eisler? Notes on Six Composers of the GDR

  &nbsp

Coupling of alpha(1)-Adrenoceptors to ERK1/2 in the Human Prostate

Introduction: alpha(1)-Adrenoceptors are considered critical for the regulation of prostatic smooth muscle tone. However, previous studies suggested further alpha(1)-adrenoceptor functions besides contraction. Here, we investigated whether alpha(1)-adrenoceptors in the human prostate may activate extracellular signal-regulated kinases (ERK1/2). Methods: Prostate tissues from patients undergoing radical prostatectomy were stimulated in vitro. Activation of ERK1/2 was assessed by Western blot analysis. Expression of ERK1/2 was studied by immunohistochemistry. The effect of ERK1/2 inhibition by U0126 on phenylephrine-induced contraction was studied in organ-bath experiments. Results: Stimulation of human prostate tissue with noradrenaline (30 mu M) or phenylephrine (10 mu M) resulted in ERK activation. This was reflected by increased levels of phosphorylated ERK1/2. Expression of ERK1/2 in the prostate was observed in smooth muscle cells. Incubation of prostate tissue with U0126 (30 mu M) resulted in ERK1/2 inhibition. Dose-dependent phenylephrine-induced contraction of prostate tissue was not modulated by U0126. Conclusions: alpha(1)-Adrenoceptors in the human prostate are coupled to ERK1/2. This may partially explain previous observations suggesting a role of alpha(1)-adrenoceptors in the regulation of prostate growth. Copyright (C) 2011 S. Karger AG, Base

Vegetation ecology of forest-savanna ecotones in the Comoé National Park (Ivory Coast): Border and ecotone detection, core-area analysis, and ecotone dynamics

Zur Entwicklung von Schutzkonzepten für Waldarten ist die exakte Bestimmung der Waldkernzone (core area) von besonderer Bedeutung. Zudem spielt die Dynamik von Waldrändern eine wichtige Rolle in der Waldsukzession und –regression. Ziel dieser Arbeit war die vegetationsökologische Analyse des Wald-Savanne-Ökotons an tropischen halbimmergrünen Waldinseln in Bezug auf Randeffekte, core area und Waldsukzession, um zu einem besseren Systemverständnis beizutragen. Die Ergebnisse dieser Arbeit stellen einen wichtigen Beitrag zur Entwicklung von Naturschutz- und Managementplänen tropischer Wälder dar.For the development of conservation concepts for forest species precise knowledge on the size of forest core area is required. For the dynamic of forest ecotones forest succession and regression play an important role. This study addressed vegetation ecological questions along forest-savanna ecotones at tropical dry forest islands with respect to forest edge effects, core area analysis and forest succession to contribute to a better understanding of the studied system. The results are of high relevance for the development of conservation and management plans in West African forests

Coupling between Stationary Marangoni and Cowley-Rosensweig Instabilities in a Deformable Ferrofluid Layer

A horizontal thin layer of ferrofluid is bordered by a solid and open to an inert gas on the other side. It is submitted to a heat gradient and a weak magnetic field, both being normal to the free deformable surface, leading to a coupling between the Marangoni phenomenon, induced by the variation of surface tension along the free deformable surface and the isothermal Cowley-Rosensweig problem, consequence of the magnetic field. The study of the steady compatibility condition shows a new pattern of stationary instability. The critical wavenumber is of O(√Bo), the Bond number Bo being smaller than 1, at a minima of the Marangoni number, that could be much less thus than its classical undeformable counterpart. For large wavelengthes, the Marangoni number depends on the Galileo number in contradistinction to earlier results