Compact coalgebras, compact quantum groups and the positive antipode

In this article -that has also the intention to survey some known results in the theory of compact quantum groups using methods different from the standard and with a strong algebraic flavor- we consider compact o-coalgebras and Hopf algebras. In the case of a o-Hopf algebra we present a proof of the characterization of the compactness in terms of the existence of a positive definite integral, and use our methods to give an elementary proof of the uniqueness - up to conjugation by an automorphism of Hopf algebras- of the compact involution appearing in [4]. We study the basic properties of the positive square root of the antipode square that is a Hopf algebra automorphism that we call the positive antipode. We use it -as well as the unitary antipode and the Nakayama automorphism- in order to enhance our understanding of the antipode itself

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Who are poor and do they remain poor?

This paper examines the link between poverty and income, on the one hand, and human capital and location, on the other. In the process, the paper proposes a shift in the household indicator of human capital from the usual education of the household head to the education of the most educated member. The paper finds poverty to be most severe and persistent for households with low human capital, and that the effect of human capital varies substantially across locations. Additionally, the paper finds that low human capital households tend to underinvest in the human capital of school-age members, thus likely perpetuating poverty

Effects of Ponderosa Pine Ecological Restoration on Forest Soils and Understory Vegetation in Northern Arizona

The human exclusion of wildfire and overgrazing by livestock since settlement have caused dramatic changes in ponderosa pine (Pinus ponderosa Dougl ex Laws) forest ecosystems. These changes include increased numbers of tree stems, reduced understory cover and diversity, and the introduction of invasive, non-native understory species. This study evaluated the coverage and species composition of understory vegetation present in the “cool-season” (late spring and early summer) in a ponderosa pine forest on grazed and ungrazed plots that had undergone restoration treatments on three different soil/geologic parent material types near Flagstaff, Arizona, twelve years after tree thinning and grazing exclosure treatments were applied. Several measured soil properties, such as soil respiration and temperature, were also evaluated in this study. Species richness of “cool-season” vegetation was influenced more by grazing practices than restoration treatments. Differences could be less or greater when vegetation that is active later in the season is measured. Vegetative cover was significantly influenced by restoration treatments (9.3% cover under open canopies and 6.5% under dense canopies), probably due to differences in competition for light and other resources (i.e. soil moisture and nutrients). Unlike finding by Abella et al. (2015), who studied “warm-season” vegetation, “cool-season” understory cover was not influenced by soil parent material type in this study, which might suggest that differences in understory cover due to soil properties are only seen shortly after restoration treatments are applied, or the time of year vegetation is evaluated may play a role in the differences seen. Soil respiration was highest on limestone soil parent material type (3.3 g C-CO2 m-2 day-1), and soil temperature was lowest under closed canopy treatments (15°C)

Assessment of microbial community structure changes by amplified ribosomal DNA restriction analysis (ARDRA)

Amplified ribosomal DNA restriction analysis (ARDRA) is a simple method based on restriction endonuclease digestion of the amplified bacterial 16S rDNA. In this study we have evaluated the suitability of this method to detect differences in activated sludge bacterial communities fed on domestic or industrial wastewater, and subject to different operational conditions. The ability of ARDRA to detect these differences has been tested in modified Ludzack-Ettinger (MLE) configurations. Samples from three activated sludge wastewater treatment plants (WWTPs) with the MLE configuration were collected for both oxic and anoxic reactors, and ARDRA patterns using double enzyme digestions AluI+MspI were obtained. A matrix of Dice similarity coefficients was calculated and used to compare these restriction patterns. Differences in the community structure due to influent characteristics and temperature could be observed, but not between the oxic and anoxic reactors of each of the three MLE configurations. Other possible applications of ARDRA for detecting and monitoring changes in activated sludge systems are also discussed

Inter-rater reliability of post-arrest cerebral performance category (CPC) scores.

PURPOSE: Cerebral Performance Category (CPC) scores are often an outcome measure for post-arrest neurologic function, collected worldwide to compare performance, evaluate therapies, and formulate recommendations. At most institutions, no formal training is offered in their determination, potentially leading to misclassification. MATERIALS AND METHODS: We identified 171 patients at 2 hospitals between 5/10/2005 and 8/31/2012 with two CPC scores at hospital discharge recorded independently - in an in-house quality improvement database and as part of a national registry. Scores were abstracted retrospectively from the same electronic medical record by two separate non-clinical researchers. These scores were compared to assess inter-rater reliability and stratified based on whether the score was concordant or discordant among reviewers to determine factors related to discordance. RESULTS: Thirty-nine CPC scores (22.8%) were discordant (kappa: 0.66), indicating substantial agreement. When dichotomized into favorable neurologic outcome (CPC 1-2)/ unfavorable neurologic outcome (CPC 3-5), 20 (11.7%) scores were discordant (kappa: 0.70), also indicating substantial agreement. Patients discharged home (as opposed to nursing/other care facility) and patients with suspected cardiac etiology of arrest were statistically more likely to have concordant scores. For the quality improvement database, patients with discordant scores had a statistically higher median CPC score than those with concordant scores. The registry had statistically lower median CPC score (CPC 1) than the quality improvement database (CPC 2); p\u3c0.01 for statistical significance. CONCLUSIONS: CPC scores have substantial inter-rater reliability, which is reduced in patients who have worse outcomes, have a non-cardiac etiology of arrest, and are discharged to a location other than home

Factors associated with post-arrest withdrawal of life-sustaining therapy.

INTRODUCTION: Most successfully resuscitated cardiac arrest patients do not survive to hospital discharge. Many have withdrawal of life sustaining therapy (WLST) as a result of the perception of poor neurologic prognosis. The characteristics of these patients and differences in their post-arrest care are largely unknown. METHODS: Utilizing the Penn Alliance for Therapeutic Hypothermia Registry, we identified a cohort of 1311 post-arrest patients from 26 hospitals from 2010 to 2014 who remained comatose after return of spontaneous circulation. We stratified patients by whether they had WLST post-arrest and analyzed demographic, arrest, and post-arrest variables. RESULTS: In our cohort, 565 (43%) patients had WLST. In multivariate regression, patients who had WLST were less likely to go to the cardiac catheterization lab (OR 0.40; 95% CI: 0.26-0.62) and had shorter hospital stays (OR 0.93; 95% CI: 0.91-0.95). When multivariate regression was limited to patient demographics and arrest characteristics, patients with WLST were older (OR 1.18; 95% CI: 1.07-1.31 by decade), had a longer arrest duration (OR 1.14; 95% CI: 1.05-1.25 per 10min), more likely to be female (OR: 1.41; 95% CI: 1.01-1.96), and less likely to have a witnessed arrest (OR 0.65; 95% CI: 0.42-0.98). CONCLUSION: Patients with WLST differ in terms of demographic, arrest, and post-arrest characteristics and treatments from those who did not have WLST. Failure to account for this variability could affect both clinical practice and the interpretation of research

Validation of an ICD code for accurately identifying emergency department patients who suffer an out-of-hospital cardiac arrest.

AIM: International classification of disease (ICD-9) code 427.5 (cardiac arrest) is utilized to identify cohorts of patients who suffer out-of-hospital cardiac arrest (OHCA), though the use of ICD codes for this purpose has never been formally validated. We sought to validate the utility of ICD-9 code 427.5 by identifying patients admitted from the emergency department (ED) after OHCA. METHODS: Adult visits to a single ED between January 2007 and July 2012 were retrospectively examined and a keyword search of the electronic medical record (EMR) was used to identify patients. Cardiac arrest was confirmed; and ICD-9 information and location of return of spontaneous circulation (ROSC) were collected. Separately, the EMR was searched for patients who received ICD-9 code 427.5. The kappa coefficient (κ) was calculated, as was the sensitivity and specificity of the code for identifying OHCA. RESULTS: The keyword search identified 1717 patients, of which 385 suffered OHCA and 333 were assigned the code 427.5. The agreement between ICD-9 code and cardiac arrest was excellent (κ = 0.895). The ICD-9 code 427.5 was both specific (99.4%) and sensitive (86.5%). Of the 52 cardiac arrests that were not identified by ICD-9 code, 33% had ROSC before arrival to the ED. When searching independently on ICD-9 code, 347 patients with ICD-9 code 427.5 were found, of which 320 were true arrests. This yielded a positive predictive value of 92% for ICD-9 code 427.5 in predicting OHCA. CONCLUSIONS: ICD-9 code 427.5 is sensitive and specific for identifying ED patients who suffer OHCA with a positive predictive value of 92%