11,666 research outputs found
Recommended from our members
Equine degenerative myeloencephalopathy: prevalence, impact, and management.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy is an inherited neurodegenerative disorder affecting many horse breeds. Clinical signs include a symmetric ataxia and an abnormal stance at rest, similar to cervical vertebral compressive myelopathy, equine protozoal myeloencephalitis, and equine herpesvirus 1 myeloencephalopathy. This review will provide an update on the disease prevalence, management, impact, and ongoing research
Gendered Synthetic Love: Real Dolls and the Construction of Intimacy
Real Dolls are life-size, anatomically correct figures. Except for their lifelessness, they are made to look and feel like humans. The availability of Real Dolls allows us to examine the social significance of relationships and gender expectations in a new light. In this paper, we are interested in how the Real Dolls are being offered and accepted as alternative partners. Specifically, we examine the relationship between the commodification of the body and the agency individuals have to create intimacy and connection. We conducted an exploratory content analysis of the customer testimonials on the Real Doll website. Results suggest that the Dolls fit into the stereotypical ideal beauty and promote the commodification of bodies. Buyers use these Dolls not just for sexual gratification but are also used for emotional support. The consequences of these attachments are discussed
Activity of human hippocampal and amygdala neurons during retrieval of declarative memories
Episodic memories allow us to remember not only that we have seen an item before but also where and when we have seen it (context). Sometimes, we can confidently report that we have seen something (familiarity) but cannot recollect where or when it was seen. Thus, the two components of episodic recall, familiarity and recollection, can be behaviorally dissociated. It is not clear, however, whether these two components of memory are represented separately by distinct brain structures or different populations of neurons in a single anatomical structure. Here, we report that the spiking activity of single neurons in the human hippocampus and amygdala [the medial temporal lobe (MTL)] contain information about both components of memory. We analyzed a class of neurons that changed its firing rate to the second presentation of a previously novel stimulus. We found that the neuronal activity evoked by the presentation of a familiar stimulus (during retrieval) distinguishes stimuli that will be successfully recollected from stimuli that will not be recollected. Importantly, the ability to predict whether a stimulus is familiar is not influenced by whether the stimulus will later be recollected. We thus conclude that human MTL neurons contain information about both components of memory. These data support a continuous strength of memory model of MTL function: the stronger the neuronal response, the better the memory
Differences in Romanian Men\u27s Online Personals by Sexualities
As Internet usage increases, its ability to provide almost instant connections and to pre-screen potential partners has made it a popular source for meeting people. To contribute to current literature, we examine differences in content between 187 men seeking men and 193 men seeking women in a sample of Romanian (Bucharest) personals in 2007. Results show that men seeking women provide more information about themselves than men seeking men. While the results also show that some Romanian men are more open about expressing their sexualities than others, there are still many obstacles affecting how men choose to share and express their sexualities in Romania
Generational Aspects of U.S. Public Opinion on Renewable Energy and Climate Change
The topics of climate change and renewable energy often are linked in policy discussions and scientific analysis, but public opinion on these topics exhibits both overlap and divergence. Although renewable energy has potentially broader acceptance than anthropogenic climate change, it can also sometimes face differently-based opposition. Analyses of U.S. and regional surveys, including time series of repeated surveys in New Hampshire (2010–2018) and northeast Oregon (2011–2018), explore the social bases of public views on both issues. Political divisions are prominent, although somewhat greater regarding climate change. Such divisions widen with education, an interaction effect documented in other studies as well. We also see robust age and temporal effects. Younger adults more often prioritize renewable energy development, and agree with scientists on the reality of anthropogenic climate change (ACC). Across all age groups and both regional series, support for renewable energy and recognition of ACC have been gradually rising. These trends, together with age-cohort replacement and possible changes in age-group voting participation, suggest that public pressure for action on these issues could grow
7 Things Churches Can Do to Make Queer People Feel Welcome
For as long as I can remember, the church, for me, has been a place characterized by shame and hurt. I remember Christian high school friends telling me that I would go to hell for being Queer. I remember hearing sermons from televangelists about the evils of homosexuality, and church leaders pressuring youth leaders to cast out their Queer members. I\u27ve heard more talk of love the sinner, hate the sin, and God didn\u27t make gay, than anyone should, and I\u27ve even received personalized hate mail declaring that God hates dykes. [excerpt
Romanian Men\u27s Masculinities in Online Personal Advertisements
The present paper analyses Romanian men\u27s masculinities via a quantitative and qualitative analysis of 380 online personal advertisements posted by men. The case of Romania is particularly interesting for understanding gender relations, since the country has recently experienced the impact of (post-) communisim, democratization, and resurging traditionalism. Romanian men\u27s advertisements often express traditional gender relations: men-seeking-women are interested in attractive, less educated partners, while men-seeking-men emphasize discretion. Some men resist such patriarchal standards: men-seeking-women who are highly educated prefer educated women, and some men-seeking-men give out recognizable photos of themselves. Limitations and further research directions are discussed
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
Identification of a novel ß-adrenergic octopamine receptor-like gene (ßAOR-like) and increased ATP-binding cassette B10 (ABCB10) expression in a Rhipicephalus microplus cell line derived from acaricide-resistant ticks
Background:
The cattle tick Rhipicephalus (Boophilus) microplus is an economically important parasite of livestock. Effective control of ticks using acaricides is threatened by the emergence of resistance to many existing compounds. Several continuous R. microplus cell lines have been established and provide an under-utilised resource for studies into acaricide targets and potential genetic mutations associated with resistance. As a first step to genetic studies using these resources, this study aimed to determine the presence or absence of two genes and their transcripts that have been linked with acaricide function in cattle ticks: β-adrenergic octopamine receptor (βAOR, associated with amitraz resistance) and ATP-binding cassette B10 (ABCB10, associated with macrocyclic lactone resistance) in six R. microplus cell lines, five other Rhipicephalus spp. cell lines and three cell lines representing other tick genera (Amblyomma variegatum, Ixodes ricinus and Hyalomma anatolicum).
Methods:
End-point polymerase chain reaction (PCR) was used for detection of the βAOR gene and transcripts in DNA and RNA extracted from the tick cell lines, followed by capillary sequencing of amplicons. Quantitative real-time PCR (qPCR) was performed to determine the levels of expression of ABCB10.
Results:
βAOR gene expression was detected in all Rhipicephalus spp. cell lines. We observed a second amplicon of approximately 220 bp for the βAOR gene in the R. microplus cell line BME/CTVM6, derived from acaricide-resistant ticks. Sequencing of this transcript variant identified a 36 bp insertion in the βAOR gene, leading to a 12-amino acid insertion (LLKTLALVTIIS) in the first transmembrane domain of the protein. In addition, nine synonymous SNPs were also discovered in R. appendiculatus, R. evertsi and R. sanguineus cell lines. Some of these SNPs appear to be unique to each species, providing potential tools for differentiating the tick species. The BME/CTVM6 cell line had significantly higher ABCB10 (P = 0.002) expression than the other R. micropluscell lines.
Conclusions:
The present study has identified a new βAOR gene and demonstrated a higher ABCB10 expression level in the BME/CTVM6 cell line, indicating that tick cell lines provide a useful experimental tool for acaricide resistance studies and further elucidation of tick genetics
- …
