Revisiting the Immune Trypanolysis Test to Optimise Epidemiological Surveillance and Control of Sleeping Sickness in West Africa

Human African trypanosomiasis (HAT) due to Trypanosoma brucei (T.b.) gambiense is usually diagnosed using two sequential steps: first the card agglutination test for trypanosomiasis (CATT) used for serological screening, followed by parasitological methods to confirm the disease. Currently, CATT will continue to be used as a test for mass screening because of its simplicity and high sensitivity; however, its performance as a tool of surveillance in areas where prevalence is low is poor because of its limited specificity. Hence in the context of HAT elimination, there is a crucial need for a better marker of contact with T.b. gambiense in humans. We evaluated here an existing highly specific serological tool, the trypanolysis test (TL). We evaluated TL in active, latent and historical HAT foci in Guinea, Côte d'Ivoire and Burkina Faso. We found that TL was a marker for exposure to T.b. gambiense. We propose that TL should be used as a surveillance tool to monitor HAT elimination

Evaluation de la teneur en protéines et en chlorophylle dans les feuilles de cinq variétés locales de manioc infectées par la mosaïque en République Centrafricaine

Assessment of Protein and Chlorophyll contents in Leaves of Five Local Varieties of Cassava Infected by African Mosaic Virus in Central African Republic. In Central African Republic, cassava has become a staple and a source of income for almost all the rural population. Cassava Mosaic Virus is a major threat to cassava production and food security for the population. The loss of production due to this disease in the country is estimated at 50%. This decrease is linked from the physiological point of view to reduction of the leaf surface, but also to a drop of the chlorophyll level. In the Central African Republic, a part of the population prefers infected cassava leaves because they would be tastier. The objective of this study was to compare the levels of protein and chlorophyll in infected and healthy leaves to verify the hypothesis that high protein content in the leaves could be associated to their contamination by the virus. The results obtained showed that the protein content is higher in the infected leaves than in the healthy ones. The rate rises on average from 12.77±0.86% of the dry weight of the leaves in healthy plants to 22.88±2.93% in diseased plants. Chlorophyll content is low in plants severely affected by the mosaic virus, and higher in healthy plants with a respective content of 13.19±1.09 mg/l and 21.81±2,17 mg/l

First Report of <i>Rice yellow mottle virus</i> in Rice in the Central African Republic

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009. </jats:p

Evaluation of trypanocidal drugs used for human African trypanosomosis against Trypanosoma lewisi contre Trypanosoma lewisi

Trypanosomes from animals are potential pathogens for humans. Several human cases infected by Try-panosoma lewisi, a parasite of rats, have been reported. The number of these infections is possibly underestimated. Some infections were self-cured, others required treatment with drugs used in human African trypanosomosis. An in vitro evaluation of these drugs and fexinidazole, a new oral drug candidate, has been performed against T. lewisi in comparison with T. brucei gambiense. All have comparable activities against the two parasites. Suramin was not effective. In vivo, drugs were tested in rats immunosuppressed by cyclophosphamide. The best efficacy was obtained for fexinidazole, and pentamidine (15 mg/kg): rats were cured in 7 and 10 days respectively. Rats receiving nifurtimoxeflornithine combination therapy (NECT) or pentamidine (4 mg/kg) were cured after 28 days, while melarsoprol was weakly active. The identification of efficient drugs with reduced toxicity will help in the management of new cases of atypical trypanosomosis

Identification of a tryptophan-like epitope borne by the variable surface glycoprotein (VSG) of African trypanosomes

Antibodies (Ab) directed against a tryptophan-like epitope (WE) were previously detected in patients with human African trypanosomiasis (HAT). We investigated whether or not these Ab resulted from immunization against trypanosome antigen(s) expressing a WE. By Western blotting, we identified an antigen having an apparent molecular weight ranging from 60 to 65 kDa, recognized by purified rabbit anti-WE Ab. This antigen, present in trypomastigote forms, was absent in procyclic forms and Trypanosoma cruzi trypomastigotes. Using purified variable surface glycoproteins (VSG) from various trypanosomes, we showed that VSG was the parasite antigen recognized by these rabbit Ab. Anti-WE and anti-VSG Ab were purified from HAT sera by affinity chromatography. Immunoreactivity of purified antibodies eluted from affinity columns and of depleted fractions showed that WE was one of the epitopes borne by VSG. These data underline the existence of an invariant WE in the structure of VSG from several species of African trypanosomes

Epidemiological assessment of cassava mosaic disease in Central African Republic reveals the importance of mixed viral infection and poor health of plant cuttings

Cassava is a vital crop in Africa and represents the main food crop in Central African Republic (CAR). CAR has recently faced large reductions in cassava yields that have led to a surge in market prices. To better understand the causes of the reduction in yield, we identified biotic constraints to cassava production by means of a large-scale plant epidemiological survey conducted in 2007 and 2008. Standard protocols were used for the assessment of the major cassava pests and diseases. Cassava mosaic disease (CMD) was shown to be the most serious constraint to cassava in CAR, with symptoms observed at all localities surveyed. CMD is distributed throughout the country, with an average incidence of 85%. Importantly, 94% of diseased plants had cutting-derived CMD infection suggesting that farmers mostly use virus-infected cuttings for planting. PCR amplification and direct sequencing of partial fragments of the Rep ORF revealed that the causal agents of CMD in CAR are African cassava mosaic virus (ACMV) and the Uganda strain of East African cassava mosaic virus (EACMV-UG). We also demonstrated that 58% of CMD samples present mixed infections (ACMV and EACMV-UG) and that these samples had significantly higher symptom severities. Our results suggest that mixed infection and synergism between CMGs, could be an important feature in the yield reduction of cassava plants in CAR, similar to the other severe CMD epidemics reported in East Africa