A homoclinic tangle on the edge of shear turbulence

Experiments and simulations lend mounting evidence for the edge state hypothesis on subcritical transition to turbulence, which asserts that simple states of fluid motion mediate between laminar and turbulent shear flow as their stable manifolds separate the two in state space. In this Letter we describe a flow homoclinic to a time-periodic edge state. Its existence explains turbulent bursting through the classical Smale-Birkhoff theorem. During a burst, vortical structures and the associated energy dissipation are highly localized near the wall, in contrast to the familiar regeneration cycle

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

The Geometry of the Vapor Layer Under a Leidenfrost Drop

In the Leidenfrost effect, liquid drops deposited on a hot surface levitate on a thin vapor cushion fed by evaporation of the liquid. This vapor layer forms a concave depression in the drop interface. Using laser-light interference coupled to high-speed imaging, we measured the radius, curvature, and height of the vapor pocket, as well as non-axisymmetric fluctuations of the interface for water drops at different temperatures. The geometry of the vapor pocket depends primarily on the drop size and not on the substrate temperature.Comment: 4 pages, 3 figure

Scales in space

Economists have devoted more attention to the scale of time than to the scale of space. What has been done in the field of space is often general and abstract, not connected to an explicit observation set in time and space. Moreover, time scales and spatial scales are not tied, making the choice for a macro, meso or microeconomic theory a rather arbitrary process. We devote attention to the explanation of the phenomenon of emerging spatial structures. We will discuss the standard economic theories that describe the underlying processes and argue that by being more explicit about spatial scales explanatory power is added to current theoretical work

A new limit on the Ultra-High-Energy Cosmic-Ray flux with the Westerbork Synthesis Radio Telescope

A particle cascade (shower) in a dielectric, for example as initiated by an ultra-high energy cosmic ray, will have an excess of electrons which will emit coherent \v{C}erenkov radiation, known as the Askaryan effect. In this work we study the case in which such a particle shower occurs in a medium just below its surface. We show, for the first time, that the radiation transmitted through the surface is independent of the depth of the shower below the surface when observed from far away, apart from trivial absorption effects. As a direct application we use the recent results of the NuMoon project, where a limit on the neutrino flux for energies above $10^{22}$\,eV was set using the Westerbork Synthesis Radio Telescope by measuring pulsed radio emission from the Moon, to set a limit on the flux of ultra-high-energy cosmic rays.Comment: Accepted for publication in Phys. Rev.

The radio emission pattern of air showers as measured with LOFAR - a tool for the reconstruction of the energy and the shower maximum

The pattern of the radio emission of air showers is finely sampled with the Low-Frequency ARray (LOFAR). A set of 382 measured air showers is used to test a fast, analytic parameterization of the distribution of pulse powers. Using this parameterization we are able to reconstruct the shower axis and give estimators for the energy of the air shower as well as the distance to the shower maximum.Comment: 15 pages, 10 figures, accepted for publication in JCA

The footprint of cometary dust analogs: I. Laboratory experiments of low-velocity impacts and comparison with Rosetta data

Cometary dust provides a unique window on dust growth mechanisms during the onset of planet formation. Measurements by the Rosetta spacecraft show that the dust in the coma of comet 67P/Churyumov-Gerasimenko has a granular structure at size scales from sub-um up to several hundreds of um, indicating hierarchical growth took place across these size scales. However, these dust particles may have been modified during their collection by the spacecraft instruments. Here we present the results of laboratory experiments that simulate the impact of dust on the collection surfaces of COSIMA and MIDAS, instruments onboard the Rosetta spacecraft. We map the size and structure of the footprints left by the dust particles as a function of their initial size (up to several hundred um) and velocity (up to 6 m/s). We find that in most collisions, only part of the dust particle is left on the target; velocity is the main driver of the appearance of these deposits. A boundary between sticking/bouncing and fragmentation as an outcome of the particle-target collision is found at v ~ 2 m/s. For velocities below this value, particles either stick and leave a single deposit on the target plate, or bounce, leaving a shallow footprint of monomers. At velocities > 2 m/s and sizes > 80 um, particles fragment upon collision, transferring up to 50 per cent of their mass in a rubble-pile-like deposit on the target plate. The amount of mass transferred increases with the impact velocity. The morphologies of the deposits are qualitatively similar to those found by the COSIMA instrument.Comment: 14 pages, 12 figures, accepted for publication in MNRA

Actors and factors - bridging social science findings and urban land use change modeling

Recent uneven land use dynamics in urban areas resulting from demographic change, economic pressure and the cities’ mutual competition in a globalising world challenge both scientists and practitioners, among them social scientists, modellers and spatial planners. Processes of growth and decline specifically affect the urban environment, the requirements of the residents on social and natural resources. Social and environmental research is interested in a better understanding and ways of explaining the interactions between society and landscape in urban areas. And it is also needed for making life in cities attractive, secure and affordable within or despite of uneven dynamics.\ud The position paper upon “Actors and factors – bridging social science findings and urban land use change modeling” presents approaches and ideas on how social science findings on the interaction of the social system (actors) and the land use (factors) are taken up and formalised using modelling and gaming techniques. It should be understood as a first sketch compiling major challenges and proposing exemplary solutions in the field of interest

Are we overusing IVF?

Peer reviewedPublisher PD