Characterization and phylogenetic analysis of multidrug-resistant protein-encoding genes in Trypanosoma evansi isolated from buffaloes in Ngawi district, Indonesia

Background and Aim: Excessive use of trypanocidal drugs can lead to cases of drug resistance. Multiple cases of resistance have been widely reported for drugs such as isometamidium chloride and diminazene aceturate. These cases deserve serious attention, especially in Indonesia, where the first case was recorded and where the molecular basis of trypanocidal drug resistance has never been evaluated. This study aimed to analyze the multidrug resistance protein (MRP) gene in Trypanosoma evansi isolates, sampled from Indonesia, by focusing on the phylogenetic relationship between these isolates and other Trypanosoma spp. Materials and Methods: A total of 88 blood samples were drawn from buffaloes in the Ngawi district, Indonesia. Animals infected with T. evansi were detected through the microhematocrit technique and Giemsa blood smear methods. Positive blood samples were used to inoculate in male mice (Mus musculus BALB-C strain) as an animal model for culturing the T. evansi. The genomic DNA of the blood taken from the T. evansi-infected mice was used for polymerase chain reaction amplification, sequencing, and phylogenetic analysis. Results: Two genes were analyzed; the first gene detected for T. evansi corresponded to Trypanosoma brucei with a homology of 99% and the second gene to Trypanosoma brucei gambiense, with a homology of 100%. These two genes of the MRP from T. evansi showed clear similarity to the MRPE and MRPA genes of the T. brucei ssp. Conclusion: The MRP gene is conserved on the subspecies level of T. brucei. Only few point mutations were found between various sequences, which mean that the proteins have the same structure. This is important to treat the parasite with the appropriate drugs in the future

Analysis of the Effects of Polymorphism on Pollen Profilin Structural Functionality and the Generation of Conformational, T- and B-Cell Epitopes

An extensive polymorphism analysis of pollen profilin, a fundamental regulator of the actin cytoskeleton dynamics, has been performed with a major focus in 3D-folding maintenance, changes in the 2-D structural elements, surface residues involved in ligands-profilin interactions and functionality, and the generation of conformational and lineal B- and T-cell epitopes variability. Our results revealed that while the general fold is conserved among profilins, substantial structural differences were found, particularly affecting the special distribution and length of different 2-D structural elements (i.e. cysteine residues), characteristic loops and coils, and numerous micro-heterogeneities present in fundamental residues directly involved in the interacting motifs, and to some extension these residues nearby to the ligand-interacting areas. Differential changes as result of polymorphism might contribute to generate functional variability among the plethora of profilin isoforms present in the olive pollen from different genetic background (olive cultivars), and between plant species, since biochemical interacting properties and binding affinities to natural ligands may be affected, particularly the interactions with different actin isoforms and phosphoinositides lipids species. Furthermore, conspicuous variability in lineal and conformational epitopes was found between profilins belonging to the same olive cultivar, and among different cultivars as direct implication of sequences polymorphism. The variability of the residues taking part of IgE-binding epitopes might be the final responsible of the differences in cross-reactivity among olive pollen cultivars, among pollen and plant-derived food allergens, as well as between distantly related pollen species, leading to a variable range of allergy reactions among atopic patients. Identification and analysis of commonly shared and specific epitopes in profilin isoforms is essential to gain knowledge about the interacting surface of these epitopes, and for a better understanding of immune responses, helping design and development of rational and effective immunotherapy strategies for the treatment of allergy diseases. [EN]This study was supported by the following European Regional Development Fund co-financed grants: MCINN BFU 2004-00601/BFI, BFU 2008-00629, BFU2011-22779, CICE (Junta de Andalucía) P2010-CVI15767, P2010-AGR6274 and P2011-CVI-7487, and by the coordinated project Spain/Germany MEC HA2004-0094. JCJ-L thanks Spanish CSIC and the European Marie Curie research program for his I3P-BPD-CSIC, and PIOF-GA-2011-301550 grants, respectively.Peer reviewe

Global mortality associated with 33 bacterial pathogens in 2019: a systematic analysis for the Global Burden of Disease Study 2019

Background Reducing the burden of death due to infection is an urgent global public health priority. Previous studies have estimated the number of deaths associated with drug-resistant infections and sepsis and found that infections remain a leading cause of death globally. Understanding the global burden of common bacterial pathogens (both susceptible and resistant to antimicrobials) is essential to identify the greatest threats to public health. To our knowledge, this is the first study to present global comprehensive estimates of deaths associated with 33 bacterial pathogens across 11 major infectious syndromes.Methods We estimated deaths associated with 33 bacterial genera or species across 11 infectious syndromes in 2019 using methods from the Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) 2019, in addition to a subset of the input data described in the Global Burden of Antimicrobial Resistance 2019 study. This study included 343 million individual records or isolates covering 11 361 study-location-years. We used three modelling steps to estimate the number of deaths associated with each pathogen: deaths in which infection had a role, the fraction of deaths due to infection that are attributable to a given infectious syndrome, and the fraction of deaths due to an infectious syndrome that are attributable to a given pathogen. Estimates were produced for all ages and for males and females across 204 countries and territories in 2019. 95% uncertainty intervals (UIs) were calculated for final estimates of deaths and infections associated with the 33 bacterial pathogens following standard GBD methods by taking the 2.5th and 97.5th percentiles across 1000 posterior draws for each quantity of interest.Findings From an estimated 13.7 million (95% UI 10.9-17.1) infection-related deaths in 2019, there were 7.7 million deaths (5.7-10.2) associated with the 33 bacterial pathogens (both resistant and susceptible to antimicrobials) across the 11 infectious syndromes estimated in this study. We estimated deaths associated with the 33 bacterial pathogens to comprise 13.6% (10.2-18.1) of all global deaths and 56.2% (52.1-60.1) of all sepsis-related deaths in 2019. Five leading pathogens-Staphylococcus aureus, Escherichia coli, Streptococcus pneumoniae, Klebsiella pneumoniae, and Pseudomonas aeruginosa-were responsible for 54.9% (52.9-56.9) of deaths among the investigated bacteria. The deadliest infectious syndromes and pathogens varied by location and age. The age-standardised mortality rate associated with these bacterial pathogens was highest in the sub-Saharan Africa super-region, with 230 deaths (185-285) per 100 000 population, and lowest in the high-income super-region, with 52.2 deaths (37.4-71.5) per 100 000 population. S aureus was the leading bacterial cause of death in 135 countries and was also associated with the most deaths in individuals older than 15 years, globally. Among children younger than 5 years, S pneumoniae was the pathogen associated with the most deaths. In 2019, more than 6 million deaths occurred as a result of three bacterial infectious syndromes, with lower respiratory infections and bloodstream infections each causing more than 2 million deaths and peritoneal and intra-abdominal infections causing more than 1 million deaths.Interpretation The 33 bacterial pathogens that we investigated in this study are a substantial source of health loss globally, with considerable variation in their distribution across infectious syndromes and locations. Compared with GBD Level 3 underlying causes of death, deaths associated with these bacteria would rank as the second leading cause of death globally in 2019; hence, they should be considered an urgent priority for intervention within the global health community. Strategies to address the burden of bacterial infections include infection prevention, optimised use of antibiotics, improved capacity for microbiological analysis, vaccine development, and improved and more pervasive use of available vaccines. These estimates can be used to help set priorities for vaccine need, demand, and development. Copyright (c) 2022 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY 4.0 license

Intraperitoneal drain placement and outcomes after elective colorectal surgery: international matched, prospective, cohort study

Despite current guidelines, intraperitoneal drain placement after elective colorectal surgery remains widespread. Drains were not associated with earlier detection of intraperitoneal collections, but were associated with prolonged hospital stay and increased risk of surgical-site infections.Background Many surgeons routinely place intraperitoneal drains after elective colorectal surgery. However, enhanced recovery after surgery guidelines recommend against their routine use owing to a lack of clear clinical benefit. This study aimed to describe international variation in intraperitoneal drain placement and the safety of this practice. Methods COMPASS (COMPlicAted intra-abdominal collectionS after colorectal Surgery) was a prospective, international, cohort study which enrolled consecutive adults undergoing elective colorectal surgery (February to March 2020). The primary outcome was the rate of intraperitoneal drain placement. Secondary outcomes included: rate and time to diagnosis of postoperative intraperitoneal collections; rate of surgical site infections (SSIs); time to discharge; and 30-day major postoperative complications (Clavien-Dindo grade at least III). After propensity score matching, multivariable logistic regression and Cox proportional hazards regression were used to estimate the independent association of the secondary outcomes with drain placement. Results Overall, 1805 patients from 22 countries were included (798 women, 44.2 per cent; median age 67.0 years). The drain insertion rate was 51.9 per cent (937 patients). After matching, drains were not associated with reduced rates (odds ratio (OR) 1.33, 95 per cent c.i. 0.79 to 2.23; P = 0.287) or earlier detection (hazard ratio (HR) 0.87, 0.33 to 2.31; P = 0.780) of collections. Although not associated with worse major postoperative complications (OR 1.09, 0.68 to 1.75; P = 0.709), drains were associated with delayed hospital discharge (HR 0.58, 0.52 to 0.66; P < 0.001) and an increased risk of SSIs (OR 2.47, 1.50 to 4.05; P < 0.001). Conclusion Intraperitoneal drain placement after elective colorectal surgery is not associated with earlier detection of postoperative collections, but prolongs hospital stay and increases SSI risk

Trends and levels of the global, regional, and national burden of appendicitis between 1990 and 2021: findings from the Global Burden of Disease Study 2021

Background Appendicitis is a common surgical emergency that poses a large clinical and economic burden. Understanding the global burden of appendicitis is crucial for evaluating unmet needs and implementing and scaling up intervention services to reduce adverse health outcomes. This study aims to provide a comprehensive assessment of the global, regional, and national burden of appendicitis, by age and sex, from 1990 to 2021. Methods Vital registration and verbal autopsy data, the Cause of Death Ensemble model (CODEm), and demographic estimates from the Global Burden of Diseases, Injuries, and Risk Factors Study (GBD) were used to estimate cause-specific mortality rates (CSMRs) for appendicitis. Incidence data were extracted from insurance claims and inpatient discharge sources and analysed with disease modelling meta-regression, version 2.1 (DisMod-MR 2.1). Years of life lost (YLLs) were estimated by combining death counts with standard life expectancy at the age of death. Years lived with disability (YLDs) were estimated by multiplying incidence estimates by an average disease duration of 2 weeks and a disability weight for abdominal pain. YLLs and YLDs were summed to estimate disability-adjusted life-years (DALYs). Findings In 2021, the global age-standardised mortality rate of appendicitis was 0·358 (95% uncertainty interval [UI] 0·311–0·414) per 100 000. Mortality rates ranged from 1·01 (0·895–1·13) per 100 000 in central Latin America to 0·054 (0·0464–0·0617) per 100 000 in high-income Asia Pacific. The global age-standardised incidence rate of appendicitis in 2021 was 214 (174–274) per 100 000, corresponding to 17 million (13·8–21·6) new cases. The incidence rate was the highest in high-income Asia Pacific, at 364 (286–475) per 100 000 and the lowest in western sub-Saharan Africa, at 81·4 (63·9–109) per 100 000. The global age-standardised rates of mortality, incidence, YLLs, YLDs, and DALYs due to appendicitis decreased steadily between 1990 and 2021, with the largest reduction in mortality and YLL rates. The global annualised rate of decline in the DALY rate was greatest in children younger than the age of 10 years. Although mortality rates due to appendicitis decreased in all regions, there were large regional variations in the temporal trend in incidence. Although the global age-standardised incidence rate of appendicitis has steadily decreased between 1990 and 2021, almost half of GBD regions saw an increase of greater than 10% in their age-standardised incidence rates. Interpretation Slow but promising progress has been observed in reducing the overall burden of appendicitis in all regions. However, there are important geographical variations in appendicitis incidence and mortality, and the relationship between these measures suggests that many people still do not have access to quality health care. As the incidence of appendicitis is rising in many parts of the world, countries should prepare their health-care infrastructure for timely, high-quality diagnosis and treatment. Given the risk that improved diagnosis may counterintuitively drive apparent rising trends in incidence, these efforts should be coupled with improved data collection, which will also be crucial for understanding trends and developing targeted interventions. Funding Bill and Melinda Gates Foundation

Prevalence, years lived with disability, and trends in anaemia burden by severity and cause, 1990-2021: findings from the Global Burden of Disease Study 2021

Background Anaemia is a major health problem worldwide. Global estimates of anaemia burden are crucial for developing appropriate interventions to meet current international targets for disease mitigation. We describe the prevalence, years lived with disability, and trends of anaemia and its underlying causes in 204 countries and territories. Methods We estimated population-level distributions of haemoglobin concentration by age and sex for each location from 1990 to 2021. We then calculated anaemia burden by severity and associated years lived with disability (YLDs). With data on prevalence of the causes of anaemia and associated cause-specific shifts in haemoglobin concentrations, we modelled the proportion of anaemia attributed to 37 underlying causes for all locations, years, and demographics in the Global Burden of Disease Study 2021. Findings In 2021, the global prevalence of anaemia across all ages was 24·3% (95% uncertainty interval [UI] 23·9–24·7), corresponding to 1·92 billion (1·89–1·95) prevalent cases, compared with a prevalence of 28·2% (27·8–28·5) and 1·50 billion (1·48–1·52) prevalent cases in 1990. Large variations were observed in anaemia burden by age, sex, and geography, with children younger than 5 years, women, and countries in sub-Saharan Africa and south Asia being particularly affected. Anaemia caused 52·0 million (35·1–75·1) YLDs in 2021, and the YLD rate due to anaemia declined with increasing Socio-demographic Index. The most common causes of anaemia YLDs in 2021 were dietary iron deficiency (cause-specific anaemia YLD rate per 100 000 population: 422·4 [95% UI 286·1–612·9]), haemoglobinopathies and haemolytic anaemias (89·0 [58·2–123·7]), and other neglected tropical diseases (36·3 [24·4–52·8]), collectively accounting for 84·7% (84·1–85·2) of anaemia YLDs. Interpretation Anaemia remains a substantial global health challenge, with persistent disparities according to age, sex, and geography. Estimates of cause-specific anaemia burden can be used to design locally relevant health interventions aimed at improving anaemia management and prevention. Funding Bill & Melinda Gates Foundation

Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi

This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed